Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250684

Morpholino Name: znf462 MO2
Synonyms: MO1 xZFPIP
mRNA Target: znf462

Morpholino Type: uncategorized morpholino
Sequence:
5' GACTTCCATATTCCTAAACCAGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 20/23
genomic

MO
5' CCTGCTTTAGGAATATGGAGGTT 3' |||| |||||||||||||| || 3' GGACCAAATCCTTATACCTTCAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold90041:182292..182314 22/23 Antisense off-target Xelaev16077931m
Scaffold102974:18288390..18288412 20/23 unknown
Scaffold208071:2606965..2606987 20/23 unknown
Scaffold52341:2536184..2536206 20/23 Sense off-target Xelaev16059828m
Scaffold61609:2579306..2579328 20/23 Antisense target znf462.S
Scaffold27038:1405421..1405443 19/23 Sense off-target Xelaev16036738m
Scaffold56777:4445201..4445223 19/23 Antisense off-target Xelaev16062643m
Scaffold96712:1429482..1429504 19/23 unknown
tropicalis 7.1 scaffold_5:105778225..105778247 19/23 unknown
scaffold_7:9909442..9909464 19/23 unknown
scaffold_8:72374926..72374948 19/23 Antisense off-target cgrrf1
Publications
First: ZFPIP/Zfp462 is maternally required for proper early Xenopus laevis development., Dev Biol 2009        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556