Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250686

Morpholino Name: znf750 MO1
Synonyms: BENI-MO
mRNA Target: znf750

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCTTGTATTTTCAGCACAGGGATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold81941:2222260..2222284 25/25 Sense off-target Xelaev16074989m
Scaffold150743:705998..706022 21/25 Sense off-target Xelaev16014815m
Scaffold175547:3770927..3770951 21/25 unknown
Scaffold193408:217930..217954 21/25 unknown
Scaffold256230:109330..109354 21/25 unknown
Scaffold52573:3733468..3733492 21/25 unknown
Scaffold74339:2056591..2056615 21/25 unknown
tropicalis 7.1 scaffold_1:112523998..112524022 21/25 Sense off-target dgkq
scaffold_2:113177202..113177226 21/25 unknown
scaffold_6:38369906..38369930 21/25 unknown
Publications
First: A novel gene, BENI is required for the convergent extension during Xenopus laevis gastrulation., Dev Biol 2007            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556