Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251637

Morpholino Name: Irx1 MO2
Synonyms:
Target mRNA: irx1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCAGCTGCGGGAAGGACATGTCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' GAGACATGTCCTTCCCTCAGCTGGG 3' |||||||||||||||| |||||||| 3' CTCTGTACAGGAAGGGCGTCGACCC 5' 5' GAGACATGTCCTTCCCGCAGCTGGG 3' ||||||||||||||||||||||||| 3' CTCTGTACAGGAAGGGCGTCGACCC 5' 5' GAGACATGTCCTTCCCGCAGCTGGG 3' ||||||||||||||||||||||||| 3' CTCTGTACAGGAAGGGCGTCGACCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:66215067..66215091 25/25 Antisense target irx1.L
chr6S:53565662..53565686 25/25 Antisense target irx1.S
chr4L:31936261..31936285 21/25 Antisense off-target irx3.L
tropicalis 10.0 Chr6:68199871..68199895 24/25 Antisense target irx1
Chr4:41854005..41854029 21/25 Antisense off-target irx3
Publications
First: The prepattern transcription factor Irx3 directs nephron segment identity., Genes Dev 2007                  
Most recent:
View All Papers