Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251641

Morpholino Name: irx3 MO3
Synonyms: Irx3(2)-MO
mRNA Target: irx3

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GAATCCCCTTTTATGACCTGACTTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AAAGTCAGGTCATAAAAGGGGATTC 3' ||||||||||||||||||||||||| 3' TTTCAGTCCAGTATTTTCCCCTAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:31936301..31936325 25/25 Antisense target irx3.L
tropicalis 10.0 Chr4:25260828..25260852 21/25 unknown
Chr5:136563675..136563699 21/25 unknown
Chr9:77325093..77325117 21/25 unknown
Publications
First: The prepattern transcription factor Irx3 directs nephron segment identity., Genes Dev 2007                  
Most recent:
View All Papers