Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251682

Morpholino Name: upf1 MO1
Synonyms:
mRNA Target: upf1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' AGCCCTCCACGCTCATTGTGACGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 20/24
genomic

MO
5' CCGTCACAATGAGCGTGGAGGCGT 3' ||||||||||||||||||||| | 3' GGCAGTGTTACTCGCACCTCCCGA 5' 5' CCATTACAATGAGCGTGGAGGCGT 3' || | |||||||||||||||| | 3' GGCAGTGTTACTCGCACCTCCCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold54274:1131429..1131452 20/24 Antisense target upf1.S
tropicalis 7.1 scaffold_1:129384406..129384429 22/24 Antisense target upf1
Publications
First: Posttranscriptional control of the stem cell and neurogenic programs by the nonsense-mediated RNA decay pathway., Cell Rep 2014  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556