Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251695

Morpholino Name: pax2 MO3
Synonyms:
mRNA Target: pax2

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TCTGCCTTGCAGTGCATATCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' CATGGATATGCACTGCAAGGCAGA 3' |||||||||||||||||||||||| 3' GTACCTATACGTGACGTTCCGTCT 5' 5' CATGGATATGCACTGCAAGGCAGA 3' |||||||||||||||||||||||| 3' GTACCTATACGTGACGTTCCGTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold10944:1274373..1274396 24/24 Antisense off-target Xelaev16002418m
Scaffold16807:3742640..3742663 24/24 Antisense target pax2.L
Scaffold179617:186436..186459 20/24 unknown
Scaffold262098:1614419..1614442 20/24 unknown
Scaffold45452:622017..622040 20/24 unknown
tropicalis 7.1 scaffold_7:42665875..42665898 24/24 Antisense target pax2
scaffold_9:68401557..68401580 21/24 unknown
scaffold_2:141167833..141167856 20/24 Sense off-target c2cd3
scaffold_2:50126262..50126285 20/24 unknown
Publications
First: Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development., Dev Biol 2015                              
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556