Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251696

Morpholino Name: pax8 MO1
Synonyms:
Target mRNA: pax8

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CAGAGCAGCTCCTTGTAGCCAATGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACATTGGCTACAAGGAGCTGCTCTG 3' ||||||||||||||||||||||||| 3' TGTAACCGATGTTCCTCGACGAGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:118183462..118183486 25/25 Antisense target pax8.L
chr7S:16486366..16486390 21/25 unknown
chr8S:28515243..28515267 21/25 unknown
tropicalis 10.0 Chr7:48765340..48765364 21/25 Sense off-target grid1
Chr8:25773643..25773667 21/25 unknown
Publications
First: Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development., Dev Biol 2015                              
Most recent:
View All Papers