Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251697

Morpholino Name: pax8 MO2
Synonyms:
Target mRNA: pax8

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CTAGTCCCTGGTAAATCCACAGTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 22/25 25/25
genomic

MO
5' GCACTGTGGATTTACCAGGGACTCG 3' ||||||||||||||||||||||| | 3' CGTGACACCTAAATGGTCCCTGATC 5' 5' GCTCTGTGGATTTACCAGGGACTCA 3' || |||||||||||||||||||| 3' CGTGACACCTAAATGGTCCCTGATC 5' 5' GCACTGTGGATTTACCAGGGACTAG 3' ||||||||||||||||||||||||| 3' CGTGACACCTAAATGGTCCCTGATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:26440526..26440550 25/25 Antisense target pax8.S
chr3L:118183481..118183505 22/25 Antisense target pax8.L
tropicalis 10.0 Chr3:125804949..125804973 24/25 Antisense target pax8
Chr8:10886529..10886553 21/25 Sense off-target LOC116406899
Chr8:10886529..10886553 21/25 Antisense off-target Xetrov107052389m.g
Publications
First: Pax8 and Pax2 are specifically required at different steps of Xenopus pronephros development., Dev Biol 2015                              
Most recent:
View All Papers