Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251698

Morpholino Name: kctd15 MO1
Synonyms:
mRNA Target: kctd15

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' TTAGAGACAGACGGGACATTTTGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' AGCAAAATGTCCCGTCTGTCTTTAA 3' ||||||||||||||||||||| ||| 3' TCGTTTTACAGGGCAGACAGAGATT 5' 5' AGCAAAATGTCCCGTCTGTCTCTAA 3' ||||||||||||||||||||||||| 3' TCGTTTTACAGGGCAGACAGAGATT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold249035:961403..961427 25/25 Antisense off-target Xelaev16033259m
Scaffold98999:1942492..1942516 25/25 Antisense target kctd15.L
Scaffold347078:694928..694952 21/25 Antisense off-target Xelaev16045698m
tropicalis 7.1 scaffold_4:38275289..38275313 24/25 Antisense target kctd15
scaffold_8811:276..300 21/25 unknown
Publications
First: Identification and characterization of Xenopus kctd15, an ectodermal gene repressed by the FGF pathway. [Int J Dev Biol 2012]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556