Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251699

Morpholino Name: ext1 MO1
Synonyms:
mRNA Target: ext1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' AGCGTTTTTTCGCCTGCATGTGTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold264180:493383..493407 25/25 Antisense off-target Xelaev16035461m
Scaffold312531:342192..342216 25/25 Antisense off-target Xelaev16041902m
Scaffold23403:9776542..9776566 21/25 unknown
tropicalis 7.1 scaffold_6:11375755..11375779 25/25 unknown
Publications
First: Zygotic expression of Exostosin1 (Ext1) is required for BMP signaling and establishment of dorsal-ventral pattern in Xenopus., Int J Dev Biol 2014            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556