Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251705

Morpholino Name: sox11 MO2
Synonyms:
mRNA Target: sox11

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TGTCCATGTCTGCTCGCTGCACCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGTGCAGCGAGCAGACATGGACA 3' ||||||||||||||||||||||||| 3' TACCACGTCGCTCGTCTGTACCTGT 5' 5' ATGGTGCAGCGAGCAGACATGGACA 3' ||||||||||||||||||||||||| 3' TACCACGTCGCTCGTCTGTACCTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:135738484..135738508 25/25 Antisense target sox11.L
chr5S:116852251..116852275 25/25 Antisense target sox11.S
chr5S:91760684..91760708 21/25 unknown
tropicalis 10.0 Chr6:66441942..66441966 22/25 unknown
Chr8:70436892..70436916 21/25 unknown
Chr9:8439517..8439541 21/25 unknown
Publications
First: Evolutionarily conserved role for SoxC genes in neural crest specification and neuronal differentiation., Dev Biol 2015                      
Most recent: Six1 and Irx1 have reciprocal interactions during cranial placode and otic vesicle formation., Dev Biol 2019                        
View All Papers