Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251707

Morpholino Name: c12orf43 MO1
Synonyms: custos-MO
mRNA Target: c12orf43

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' CGCCGCCATCTTACTTGTTGGTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold112554:2474985-2475008 20/24 Antisense off-target Xelaev16003400m
Publications
First: Custos controls β-catenin to regulate head development during vertebrate embryogenesis. [Proc Natl Acad Sci U S A 2014]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556