Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251716

Morpholino Name: ventx1.1 MO1
Synonyms:
mRNA Target: ventx1.1

Morpholino Type: uncategorized morpholino
Sequence:
5' GTCAATAGAGAATCCCTGTTGAACC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGTTCAACAGGGATTCTCTATTGAC 3' ||||||||||||||||||||||||| 3' CCAAGTTGTCCCTAAGAGATAACTG 5' 5' GGTTCAACAGGGATTCTCTATTGAC 3' ||||||||||||||||||||||||| 3' CCAAGTTGTCCCTAAGAGATAACTG 5' 5' GGTTCAACAGGGATTCTCTATTGAC 3' ||||||||||||||||||||||||| 3' CCAAGTTGTCCCTAAGAGATAACTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold151047:85..109 25/25 unknown
Scaffold16863:2495736..2495760 25/25 Antisense target ventx1.1.S
Scaffold252807:85..109 25/25 unknown
Scaffold7555:1678291..1678315 25/25 Antisense target ventx1.1.L
tropicalis 7.1 scaffold_7:21462820..21462844 25/25 Antisense off-target ventx1.2
scaffold_7:21498314..21498338 25/25 Antisense target ventx1.1
scaffold_5:102064575..102064599 21/25 unknown
Publications
First: The opposing homeobox genes Goosecoid and Vent1/2 self-regulate Xenopus patterning., EMBO J 2007                
Most recent: Xbra and Smad-1 cooperate to activate the transcription of neural repressor ventx1.1 in Xenopus embryos., Sci Rep 2018                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556