Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251717

Morpholino Name: ventx1.1 MO2
Synonyms:
mRNA Target: ventx1.1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATAGAGAATCCCTGTTGAACCATGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GCATGGTTCAACAGGGATTCTCTAT 3' ||||||||||||||||||||||||| 3' CGTACCAAGTTGTCCCTAAGAGATA 5' 5' GCATGGTTCAACAGGGATTCTCTAT 3' ||||||||||||||||||||||||| 3' CGTACCAAGTTGTCCCTAAGAGATA 5' 5' GCATGGTTCAACAGGGATTCTCTAT 3' ||||||||||||||||||||||||| 3' CGTACCAAGTTGTCCCTAAGAGATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold151047:81..105 25/25 unknown
Scaffold16863:2495732..2495756 25/25 Antisense target ventx1.1.S
Scaffold252807:81..105 25/25 unknown
Scaffold7555:1678287..1678311 25/25 Antisense target ventx1.1.L
tropicalis 7.1 scaffold_7:21462816..21462840 25/25 Antisense off-target ventx1.2
scaffold_7:21498318..21498342 25/25 Antisense target ventx1.1
Publications
First: A p38 MAPK-CREB pathway functions to pattern mesoderm in Xenopus., Dev Biol 2008          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556