Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251718

Morpholino Name: ventx2.1 MO2
Synonyms:
mRNA Target: ventx2.1

Morpholino Type: uncategorized morpholino
Sequence:
5' GTCATCTTGTCTGTATTAGTCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23 23/23
genomic

MO
5' AGGACTAATACAGACAAGATGAC 3' ||||||||||||||||||||||| 3' TCCTGATTATGTCTGTTCTACTG 5' 5' AGGACTAATACAGACAAGATGAC 3' ||||||||||||||||||||||| 3' TCCTGATTATGTCTGTTCTACTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:2485294..2485316 23/23 Antisense target ventx2.1.S
Scaffold295070:9..31 23/23 unknown
Scaffold7555:1662296..1662318 23/23 Antisense target ventx2.1.L
Scaffold163806:5321584..5321606 20/23 unknown
Scaffold314296:1651303..1651325 20/23 unknown
Scaffold31653:1343124..1343146 19/23 unknown
Scaffold34503:3625210..3625232 19/23 unknown
Scaffold49557:1071506..1071528 19/23 unknown
Scaffold52352:2135427..2135449 19/23 unknown
Scaffold7197:310069..310091 19/23 Sense off-target Xelaev16070135m
tropicalis 7.1 scaffold_1:77949809..77949831 20/23 unknown
scaffold_2:89684204..89684226 19/23 unknown
scaffold_5:122594054..122594076 19/23 Antisense off-target cul9
scaffold_6:21501832..21501854 19/23 Sense off-target vps13b
Publications
First: The opposing homeobox genes Goosecoid and Vent1/2 self-regulate Xenopus patterning., EMBO J 2007                
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556