Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251719

Morpholino Name: ventx2.1 MO3
Synonyms:
mRNA Target: ventx2.1

Morpholino Type: uncategorized morpholino
Sequence:
5' TTTAGTCATCTTGTCTGTATTAGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GACTAATACAGACAAGATGACTAAA 3' ||||||||||||||||||||||||| 3' CTGATTATGTCTGTTCTACTGATTT 5' 5' GACTAATACAGACAAGATGACCAAA 3' ||||||||||||||||||||| ||| 3' CTGATTATGTCTGTTCTACTGATTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold7555:1662298..1662322 25/25 Antisense target ventx2.1.L
Scaffold16863:2485296..2485320 24/25 Antisense target ventx2.1.S
Scaffold295070:11..35 24/25 unknown
Scaffold5732:7101357..7101381 22/25 unknown
Scaffold103958:76280..76304 21/25 unknown
Scaffold248098:21..45 21/25 unknown
Scaffold31653:1343120..1343144 21/25 unknown
Scaffold67052:599385..599409 21/25 unknown
Scaffold9266:5821038..5821062 21/25 Sense off-target iqgap1.L
tropicalis 7.1 scaffold_3:65899488..65899512 21/25 Sense off-target arhgap26
Publications
First: A p38 MAPK-CREB pathway functions to pattern mesoderm in Xenopus., Dev Biol 2008          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556