Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251721

Morpholino Name: ventx1.1 MO3
Synonyms:
mRNA Target: ventx1.1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CAATAGAGAATCCCTGTTGAACCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGTTCAACAGGGATTCTCTATTG 3' ||||||||||||||||||||||||| 3' TACCAAGTTGTCCCTAAGAGATAAC 5' 5' ATGGTTCAACAGGGATTCTCTATTG 3' ||||||||||||||||||||||||| 3' TACCAAGTTGTCCCTAAGAGATAAC 5' 5' ATGGTTCAACAGGGATTCTCTATTG 3' ||||||||||||||||||||||||| 3' TACCAAGTTGTCCCTAAGAGATAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold151047:83..107 25/25 unknown
Scaffold16863:2495734..2495758 25/25 Antisense target ventx1.1.S
Scaffold252807:83..107 25/25 unknown
Scaffold7555:1678289..1678313 25/25 Antisense target ventx1.1.L
tropicalis 7.1 scaffold_7:21462818..21462842 25/25 Antisense off-target ventx1.2
scaffold_7:21498316..21498340 25/25 Antisense target ventx1.1
scaffold_2:119636222..119636246 21/25 unknown
Publications
First: A study of mesoderm patterning through the analysis of the regulation of Xmyf-5 expression., Development 2002          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556