Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251722

Morpholino Name: ventx2.1 MO4
Synonyms:
mRNA Target: ventx2.1

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCCTGTAGTAGTCCTTGTGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 21/25 22/25
genomic

MO
5' ATGAACACAAGGACTACTACAGGAA 3' ||||||||||||||||||||||||| 3' TACTTGTGTTCCTGATGATGTCCTT 5' 5' AAGAACACAAGGACTAATACAGACA 3' | |||||||||||||| ||||| | 3' TACTTGTGTTCCTGATGATGTCCTT 5' 5' ATGAACACAAGGACTAATACAGACA 3' |||||||||||||||| ||||| | 3' TACTTGTGTTCCTGATGATGTCCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:2485285..2485309 22/25 Antisense target ventx2.1.S
Scaffold114358:897608..897632 21/25 unknown
Scaffold295070:1..24 21/25 unknown
Scaffold7555:1662287..1662311 21/25 Antisense target ventx2.1.L
tropicalis 7.1 scaffold_7:21483241..21483265 25/25 Antisense off-target ventx2.2
scaffold_7:21510953..21510977 25/25 Antisense target ventx2.1
Publications
First: A study of mesoderm patterning through the analysis of the regulation of Xmyf-5 expression., Development 2002          
Most recent: Functional specificity of the Xenopus T-domain protein Brachyury is conferred by its ability to interact with Smad1., Dev Cell 2005    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556