Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251725

Morpholino Name: gbx2.2 MO1
Synonyms:
Target mRNA: gbx2.2

Morpholino Type: splice blocking morpholino
Sequence: 5' GTGATGGTTGCTACACTTACCTAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCTAGGTAAGTGTAGCAACCATCAC 3' ||||||||||||||||||||||||| 3' AGATCCATTCACATCGTTGGTAGTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:72707206..72707230 25/25 Antisense target gbx2.2.L
chr9_10L:72719237..72719261 25/25 Antisense off-target gbx2.1.L
tropicalis 10.0 Chr2:10516679..10516703 21/25 Sense off-target tmprss2.13
Publications
First: The posteriorizing gene Gbx2 is a direct target of Wnt signalling and the earliest factor in neural crest induction., Development 2009              
Most recent: Apolipoprotein C-I mediates Wnt/Ctnnb1 signaling during neural border formation and is required for neural crest development., Int J Dev Biol 2017                        
View All Papers