Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251737

Morpholino Name: foxg1 MO1
Synonyms:
Target mRNA: foxg1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' TCACAAGGATTGGAGCCGGACACTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAGTGTCCGGCTCCAATCCTTGTGA 3' ||||||||||||||||||||||||| 3' CTCACAGGCCGAGGTTAGGAACACT 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr8:112469292..112469316 25/25 Antisense target foxg1
Publications
First: FoxG1 and TLE2 act cooperatively to regulate ventral telencephalon formation., Development 2010                                        
Most recent:
View All Papers