Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251739

Morpholino Name: foxh1 MO2
Synonyms:
Target mRNA: foxh1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TCATCCTGAGGCTCCGCCCTCTCTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TAGAGAGGGCGGAGCCTCAGGATGA 3' ||||||||||||||||||||||||| 3' ATCTCTCCCGCCTCGGAGTCCTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr6:152149232..152149256 25/25 Antisense target foxh1
Chr10:3366153..3366177 21/25 Antisense off-target LOC116407958
Chr10:3382236..3382260 21/25 Antisense off-target LOC116407958
Publications
First: Genome-wide view of TGFβ/Foxh1 regulation of the early mesendoderm program., Development 2014                                    
Most recent: Endodermal Maternal Transcription Factors Establish Super-Enhancers during Zygotic Genome Activation., Cell Rep 2019                            
View All Papers