Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251898

Morpholino Name: wnt11b MO3
Synonyms:
mRNA Target: wnt11b

Morpholino Type: splice blocking morpholino
Sequence:
5' GACACAGGACAGGTAAGCTTATCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGGATAAGCTTACCTGTCCTGTGTC 3' ||||||||||||||||||||||||| 3' TCCTATTCGAATGGACAGGACACAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36991:2151391..2151415 25/25 Sense target wnt11b.L
tropicalis 7.1 scaffold_8:24207925..24207949 23/25 unknown
Publications
First: The alternative splicing regulator Tra2b is required for somitogenesis and regulates splicing of an inhibitory Wnt11b isoform., Cell Rep 2015                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556