Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251910

Morpholino Name: cnr1 MO2
Synonyms:
mRNA Target: cnr1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' CAGGTGGAATCAAATTCTCTTTGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 21/25 25/25
genomic

MO
5' TCCAAACAGAATTTGATTTCATCAG 3' |||||| ||||||||||| || | | 3' AGGTTTCTCTTAAACTAAGGTGGAC 5' 5' TTCAAAGAGAATTTGATTTCATCAG 3' | |||||||||||||||| || | | 3' AGGTTTCTCTTAAACTAAGGTGGAC 5' 5' TCCAAAGAGAATTTGATTCCACCTG 3' ||||||||||||||||||||||||| 3' AGGTTTCTCTTAAACTAAGGTGGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5S:69093718..69093742 25/25 Antisense target cnr1.S
chr5L:87683218..87683242 21/25 Antisense target cnr1.L
tropicalis 10.0 Chr5:86667942..86667966 21/25 Antisense target cnr1
Publications
First: cnrip1 is a regulator of eye and neural development in Xenopus laevis., Genes Cells 2015                            
Most recent:
View All Papers