Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251924

Morpholino Name: efnb3 MO1
Synonyms:
mRNA Target: efnb3

Morpholino Type: uncategorized morpholino
Sequence:
5' CGGGAAAACATGCTGATTAAAGGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCCCTTTAATCAGCATGTTTTCCCG 3' ||||||||||||||||||||||||| 3' CGGGAAATTAGTCGTACAAAAGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold83691:1790908..1790932 25/25 Antisense target efnb3.L
Scaffold215439:808723..808747 21/25 unknown
Scaffold23403:3524258..3524282 21/25 unknown
Scaffold354435:500504..500528 21/25 Antisense off-target Xelaev16046435m
Scaffold6590:10955036..10955060 21/25 unknown
Publications
First: Variable combinations of specific ephrin ligand/Eph receptor pairs control embryonic tissue separation., PLoS Biol 2014                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556