Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251925

Morpholino Name: ephb2 MO1
Synonyms:
mRNA Target: ephb2

Morpholino Type:
Sequence:
5' CCCCATAGTCCTGGAAGGCCAGGTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' TACTTGGCCTTCCAGGACTATGGGG 3' ||| ||||||||||||||||||||| 3' ATGGACCGGAAGGTCCTGATACCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold68269:107409..107433 24/25 Antisense target ephb2.L
Scaffold139078:1630561..1630585 21/25 Sense off-target Xelaev16011966m
Scaffold3586:3052448..3052472 21/25 unknown
Publications
First: Variable combinations of specific ephrin ligand/Eph receptor pairs control embryonic tissue separation. [PLoS Biol 2014]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556