Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251944

Morpholino Name: Mapt MO2
Synonyms: tau MO
Target mRNA: mapt

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTCCTAACGGTGCTGCCCGGTGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' AACACCGGGCAGCACCGTTAGGACT 3' ||||||||||||||||||||||||| 3' TTGTGGCCCGTCGTGGCAATCCTGA 5' 5' AACACCGGGCAGCACCGTTAGGACT 3' ||||||||||||||||||||||||| 3' TTGTGGCCCGTCGTGGCAATCCTGA 5' 5' AATACCGGGCAGCACCGTTAGGACT 3' || |||||||||||||||||||||| 3' TTGTGGCCCGTCGTGGCAATCCTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:6152784..6152808 25/25 Antisense target mapt.L
chr9_10S:5606483..5606507 24/25 Antisense target mapt.S
chr9_10L:6152784..6152808 25/25 Sense off-target Xelaev18043332m
tropicalis 10.0 Chr10:17220601..17220625 25/25 Antisense target mapt
Publications
First: Microtubule-associated protein tau promotes neuronal class II β-tubulin microtubule formation and axon elongation in embryonic Xenopus laevis., Eur J Neurosci 2015              
Most recent:
View All Papers