Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252061

Morpholino Name: nol11 MO1
Synonyms:
mRNA Target: nol11

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GCTCCCCGAGAGCGGCCATCTTGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 21/25 22/25
genomic

MO
5' GACAAGATGGCCGCTCTCAGGGAGC 3' |||||||||||||||||| |||||| 3' CTGTTCTACCGGCGAGAGCCCCTCG 5' 5' GTCAAGATGGCCGCTCTCAGTGAAC 3' | |||||||||||||||| | || | 3' CTGTTCTACCGGCGAGAGCCCCTCG 5' 5' GTCAAGATGGCCGCTCTCAGTGAGC 3' | |||||||||||||||| | |||| 3' CTGTTCTACCGGCGAGAGCCCCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:39880652..39880676 22/25 Antisense target nol11.S
chr9_10L:43703847..43703871 21/25 Antisense target nol11.L
tropicalis 10.0 Chr10:51269674..51269698 24/25 Antisense target nol11
Chr10:51269674..51269698 24/25 Antisense off-target Xetrov107011935m.g
Publications
First: The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus., PLoS Genet 2015                                
Most recent:
View All Papers