Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252154

Morpholino Name: ets1 MO1
Synonyms: ets1MO2b
mRNA Target: ets1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TAAGGTCTAGTGCAGCTTTCATGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 22/25
genomic

MO
5' GCCATGAAAGCTGCGCTAGACCTTA 3' |||||||||||||| |||||||||| 3' CGGTACTTTCGACGTGATCTGGAAT 5' 5' GCCATGAAAGCTGCACTAGACCTTA 3' ||||||||||||||||||||||||| 3' CGGTACTTTCGACGTGATCTGGAAT 5' 5' GCCATGAAAGCTGCGCTAGATCTCA 3' |||||||||||||| ||||| || | 3' CGGTACTTTCGACGTGATCTGGAAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold166674:4678196..4678220 25/25 Antisense target ets1.L
Scaffold226594:1038475..1038499 22/25 Antisense target ets1.S
Scaffold373399:1086987..1087011 21/25 unknown
tropicalis 7.1 scaffold_7:87629763..87629787 24/25 Antisense target ets1
Publications
First: Dual developmental role of transcriptional regulator Ets1 in Xenopus cardiac neural crest vs. heart mesoderm., Cardiovasc Res 2015  
Most recent: The Proto-oncogene Transcription Factor Ets1 Regulates Neural Crest Development through Histone Deacetylase 1 to Mediate Output of Bone Morphogenetic Protein Signaling., J Biol Chem 2015                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556