Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252155

Morpholino Name: mcc MO1
Synonyms:
mRNA Target: mcc

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TTCTGCATGATTGAATGGTTCTGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold12879:4908304..4908328 25/25 Antisense off-target Xelaev16008176m
Scaffold373399:815284..815308 25/25 Antisense off-target Xelaev16048549m
Scaffold9266:7526408..7526432 22/25 Sense off-target Xelaev16078832m
Scaffold8129:9047773..9047797 21/25 unknown
tropicalis 7.1 scaffold_1:33883729..33883753 25/25 unknown
scaffold_8:81693188..81693212 22/25 Antisense off-target pcnx4
scaffold_4:40619774..40619798 21/25 unknown
scaffold_6:61855602..61855626 21/25 unknown
Publications
First: The PDZ domain protein Mcc is a novel effector of non-canonical Wnt signaling during convergence and extension in zebrafish., Development 2014          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.3


Major funding for Xenbase is provided by grant P41 HD064556