Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252155

Morpholino Name: mcc MO1
Synonyms:
mRNA Target: mcc

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TTCTGCATGATTGAATGGTTCTGTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CACAGAACCATTCAATCATGCAGAA 3' ||||||||||||||||||||||||| 3' GTGTCTTGGTAAGTTAGTACGTCTT 5' 5' CACAGAACCATTCAATCATGCAGAA 3' ||||||||||||||||||||||||| 3' GTGTCTTGGTAAGTTAGTACGTCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:174418430..174418454 25/25 Antisense off-target LOC108717348 [provisional:mcc]
chr1S:144840370..144840394 25/25 Antisense target mcc.S
chr3L:98862759..98862783 22/25 Sense off-target znf710.L
chr2S:121485474..121485498 21/25 unknown
tropicalis 10.0 Chr1:172746223..172746247 25/25 Antisense target mcc
Chr4:55637321..55637345 21/25 unknown
Chr6:87863208..87863232 21/25 unknown
Publications
First: The PDZ domain protein Mcc is a novel effector of non-canonical Wnt signaling during convergence and extension in zebrafish., Development 2014          
Most recent:
View All Papers