Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252160

Morpholino Name: pqbp1 MO1
Synonyms:
mRNA Target: pqbp1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCTAAAGGGAGAGGCATCCTGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/24 24/24
genomic

MO
5' CCCAGGATGCCTCTTCCATTAGCG 3' ||||||||||||| || |||||| 3' CGGTCCTACGGAGAGGGAAATCGC 5' 5' GCCAGGATGCCTCTCCCTTTAGCG 3' |||||||||||||||||||||||| 3' CGGTCCTACGGAGAGGGAAATCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:84933097..84933120 24/24 Antisense target pqbp1.S
chr8L:683743..683766 21/24 Antisense target pqbp1.L
Scaffold66:386444..386467 20/24 Sense off-target Xetrov90017200m.1
chr8L:11466268..11466291 20/24 unknown
Publications
First: The splicing factor PQBP1 regulates mesodermal and neural development through FGF signaling., Development 2014                                            
Most recent:
View All Papers