Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252162

Morpholino Name: pqbp1 MO3
Synonyms: pqbp1b MO
mRNA Target: pqbp1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACCGACACGCTCCTGCTCCTACTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGAGTAGGAGCAGGAGCGTGTCGGT 3' ||||||||||||||||||||||||| 3' TCTCATCCTCGTCCTCGCACAGCCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:684777..684801 25/25 Antisense target pqbp1.L
tropicalis 10.0 Chr4:151629285..151629309 21/25 unknown
Publications
First: The splicing factor PQBP1 regulates mesodermal and neural development through FGF signaling., Development 2014                                            
Most recent:
View All Papers