Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252163

Morpholino Name: wbp11 MO1
Synonyms:
mRNA Target: wbp11

Morpholino Type:
Sequence:
5' ATGTCCTCTCTCCACCAATATCAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TATGATATTGGTGGAGAGAGGACAT 3' | ||||||||||||||||||||||| 3' AGACTATAACCACCTCTCTCCTGTA 5' 5' TCTGATATTGGTGGAGAGAGGACAT 3' ||||||||||||||||||||||||| 3' AGACTATAACCACCTCTCTCCTGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold187321:2245084..2245108 25/25 Antisense off-target Xelaev16023327m
Scaffold315413:146391..146415 25/25 Antisense target wbp11.S
Scaffold137507:3207372..3207396 21/25 unknown
Scaffold175851:24..48 21/25 unknown
Scaffold182724:184..208 21/25 unknown
Scaffold41758:89..113 21/25 unknown
tropicalis 7.1 scaffold_4:86388475..86388499 24/25 Antisense target wbp11
Publications
First: The splicing factor PQBP1 regulates mesodermal and neural development through FGF signaling. [Development 2014]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556