Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252163

Morpholino Name: wbp11 MO1
Synonyms:
mRNA Target: wbp11

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGTCCTCTCTCCACCAATATCAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' TATGATATTGGTGGAGAGAGGACAT 3' | ||||||||||||||||||||||| 3' AGACTATAACCACCTCTCTCCTGTA 5' 5' TCTGATATTGGTGGAGAGAGGACAT 3' ||||||||||||||||||||||||| 3' AGACTATAACCACCTCTCTCCTGTA 5' 5' TCTGATATTGGTGGAGAGAGGACAT 3' ||||||||||||||||||||||||| 3' AGACTATAACCACCTCTCTCCTGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:122228374..122228398 25/25 Antisense target wbp11.L
chr4S:100921842..100921866 25/25 Antisense target wbp11.S
Scaffold109724:184..208 21/25 unknown
Scaffold36453:89..113 21/25 unknown
chr3L:8990307..8990331 21/25 unknown
tropicalis 10.0 Chr4:128405163..128405187 24/25 Antisense target wbp11
Publications
First: The splicing factor PQBP1 regulates mesodermal and neural development through FGF signaling., Development 2014                                            
Most recent:
View All Papers