Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252253

Morpholino Name: efna3 MO1
Synonyms:
mRNA Target: efna3

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAGAAGCACAAACACCACAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold154892:270281..270305 25/25 Sense off-target Xelaev16015951m
Scaffold51654:91348..91372 22/25 Antisense off-target sycp2l.S
Scaffold11405:232674..232698 21/25 unknown
Scaffold200825:5973428..5973452 21/25 unknown
Scaffold24235:2834092..2834116 21/25 Antisense off-target Xelaev16032057m
Scaffold4321:1774455..1774479 21/25 Sense off-target Xelaev16052936m
Scaffold52341:1112634..1112658 21/25 unknown
Scaffold86352:197417..197441 21/25 unknown
tropicalis 7.1 scaffold_1:21445686..21445710 22/25 Sense off-target arl15
scaffold_6:106661979..106662003 22/25 Antisense off-target itgb8
scaffold_171:155829..155853 21/25 unknown
scaffold_3b:293155..293179 21/25 Antisense off-target zp3
scaffold_4:95644291..95644315 21/25 Antisense off-target patj
scaffold_9:48728168..48728192 21/25 unknown
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556