Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252260

Morpholino Name: glis2 MO1
Synonyms:
mRNA Target: glis2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCTTCTTTGGTCTTTCCAAAATGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 22/25
genomic

MO
5' GTCATTTTGGGAACACCAAAGAAGA 3' | |||||||| || ||||||||||| 3' CCGTAAAACCTTTCTGGTTTCTTCT 5' 5' GACATTTTGGAAACATCAAAGAAGA 3' | ||||||||||| | ||||||||| 3' CCGTAAAACCTTTCTGGTTTCTTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold23403:3059452..3059476 25/25 unknown
Scaffold160841:4256230..4256254 22/25 unknown
Scaffold939:4005917..4005941 22/25 Antisense target glis2.L
Scaffold112487:676176..676200 21/25 unknown
Scaffold1421:216259..216283 21/25 unknown
Scaffold237598:1640057..1640081 21/25 unknown
tropicalis 7.1 scaffold_9:79343737..79343761 22/25 Antisense target glis2
scaffold_2:72021010..72021034 21/25 unknown
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556