Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252262

Morpholino Name: hat1 MO1
Synonyms:
mRNA Target: hat1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTCAGCCAATTTCTTTTCCATAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GCTATGGAAAAGAAATTAGCCGAGT 3' ||||||||||||||||| || |||| 3' CGATACCTTTTCTTTAACCGACTCA 5' 5' GCTATGGAAAAGAAATTGGCTGAGT 3' ||||||||||||||||||||||||| 3' CGATACCTTTTCTTTAACCGACTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold43242:6258515..6258539 25/25 Antisense target hat1.L
Scaffold4321:7246066..7246090 24/25 Antisense off-target Xelaev16053079m
Scaffold229341:506112..506136 22/25 unknown
Scaffold152894:1851599..1851623 21/25 Sense off-target Xelaev16015321m
Scaffold17127:1851630..1851654 21/25 unknown
Scaffold200825:5426863..5426887 21/25 unknown
Scaffold338948:116..140 21/25 unknown
Scaffold61124:5418978..5419002 21/25 Antisense off-target slc25a13.L
Scaffold90080:468841..468865 21/25 unknown
tropicalis 7.1 scaffold_9:18089811..18089835 23/25 Antisense target hat1
scaffold_1:65514083..65514107 21/25 unknown
scaffold_290:104514..104538 21/25 Antisense off-target saysd1
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556