Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252265

Morpholino Name: mecp2 MO2
Synonyms:
mRNA Target: mecp2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCTCGGCGCAGCGGCCATTTTCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genomic

MO
5' TAGAAAATGGCCGCTGCGCCGAGCG 3' |||||||||||||||||||||||| 3' CTCTTTTACCGGCGACGCGGCTCGC 5' 5' TAGAAAATGGCCGCTGCGCCGAGCG 3' |||||||||||||||||||||||| 3' CTCTTTTACCGGCGACGCGGCTCGC 5' 5' TAGAAAATGGCCGCTGCGCCGAGCG 3' |||||||||||||||||||||||| 3' CTCTTTTACCGGCGACGCGGCTCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold50:141818..141842 24/25 Antisense target mecp2.L
chr8S:37682417..37682441 24/25 Antisense target mecp2.S
chr8L:40442863..40442887 21/25 unknown
tropicalis 10.0 Chr8:32312843..32312867 24/25 Antisense target mecp2
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
Most recent:
View All Papers