Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17252272

Morpholino Name: r3hdm2 MO1
Synonyms:
mRNA Target: r3hdm2

Morpholino Type:
Sequence:
5' CATGGGACATCTTCAGCATAATACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' TGTATTATGCTGAAGATGTCCCATG 3' ||||||||||||||||||||||||| 3' ACATAATACGACTTCTACAGGGTAC 5' 5' TGTATTATGCTGAAGATGTCCCATG 3' ||||||||||||||||||||||||| 3' ACATAATACGACTTCTACAGGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5732:922865-922889 25/25 Antisense off-target Xelaev16062999m
Scaffold70222:1057339-1057363 25/25 Antisense target r3hdm2.L
Scaffold109184:858991-859015 21/25 Antisense off-target Xelaev16002236m
Scaffold112554:486450-486474 21/25 unknown
Scaffold26505:1509799-1509823 21/25 Sense off-target Xelaev16035539m
Scaffold270768:714296-714320 21/25 unknown
Scaffold376822:143818-143842 21/25 unknown
Scaffold39723:626408-626432 21/25 unknown
Scaffold44494:4704598-4704622 21/25 unknown
Scaffold83106:350675-350699 21/25 Antisense off-target spa17.L
Scaffold86871:1569158-1569182 21/25 unknown
tropicalis 7.1 scaffold_2:84217510-84217534 25/25 Antisense target r3hdm2
scaffold_3:112200386-112200410 21/25 Antisense off-target kin
Publications
First: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556