Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306210

Morpholino Name: lefty MO7
Synonyms:
mRNA Target: lefty

Morpholino Type: uncategorized morpholino
Sequence:
5' CATGTGCTAGTGACACCCATCTTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCAAGATGGGTGTCACTAGCACATG 3' ||||||||||||||||||||||||| 3' CGTTCTACCCACAGTGATCGTGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_5:117933039..117933063 25/25 Antisense target lefty
Publications
First: E2a is necessary for Smad2/3-dependent transcription and the direct repression of lefty during gastrulation., Dev Cell 2015                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556