Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306214

Morpholino Name: sox5 MO3
Synonyms:
mRNA Target: sox5

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' CTGCCTCCTCCTCCGCTTCCCGACT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGTCGGGAAGCGGAGGAGGAGGCAG 3' ||||||||||||||||||||||||| 3' TCAGCCCTTCGCCTCCTCCTCCGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold70246:208594..208618 25/25 Antisense target sox5.S
Scaffold47683:2985378..2985402 22/25 Sense off-target Xelaev16057389m
Scaffold17127:7994082..7994106 21/25 unknown
Scaffold86347:173481..173505 21/25 Antisense off-target Xelaev16076495m
Publications
First: Sox5 Is a DNA-binding cofactor for BMP R-Smads that directs target specificity during patterning of the early ectoderm., Dev Cell 2014                                
Most recent: NEURODEVELOPMENT. Shared regulatory programs suggest retention of blastula-stage potential in neural crest cells., Science 2015  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556