Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306243

Morpholino Name: nkx6-3 MO1
Synonyms:
mRNA Target: nkx6-3

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' TAGGCCTTCTGCTCTCTCAACATGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CCATGTTGAGAGTGCAGAAGGCCTA 3' |||||||||||| |||||||||||| 3' GGTACAACTCTCTCGTCTTCCGGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold27313:177621..177645 25/25 Antisense off-target Xelaev16037499m
Scaffold59267:761975..761999 25/25 Antisense off-target Xelaev16065057m
tropicalis 7.1 scaffold_3:7462279..7462303 24/25 Antisense target nkx6-3
scaffold_10:32216768..32216792 21/25 unknown
Publications
First: Xenopus Nkx6.3 is a neural plate border specifier required for neural crest development., PLoS One 2014            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556