Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306460

Morpholino Name: fzd7 MO4
Synonyms:
mRNA Target: fzd7

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CGAGACTGTAGAGGACATGCTGACT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGTCAGCATGTCCTCTACAGTCTCG 3' ||||||||||||||||||||||||| 3' TCAGTCGTACAGGAGATGTCAGAGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:79371430..79371454 25/25 Antisense target fzd7.L
chr3S:30069685..30069709 21/25 unknown
tropicalis 10.0 Chr6:128902969..128902993 21/25 unknown
Publications
First: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation., J Cell Biol 2015                      
Most recent:
View All Papers