Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306475

Morpholino Name: fzd7 MO5
Synonyms:
mRNA Target: fzd7

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' GCGGAGTGAGCAGAAATCGGCTGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATCAGCCGATTTCTGCTCACTCCGC 3' ||||||||||||||||||||||||| 3' TAGTCGGCTAAAGACGAGTGAGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:72104771..72104795 25/25 Antisense target fzd7.S
tropicalis 10.0 Chr1:81173850..81173874 21/25 Antisense off-target slc4a4
Publications
First: Xenopus frizzled-7 morphant displays defects in dorsoventral patterning and convergent extension movements during gastrulation., Genesis 2001    
Most recent: Syndecan4 coordinates Wnt/JNK and BMP signaling to regulate foregut progenitor development., Dev Biol 2016                                    
View All Papers