Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306476

Morpholino Name: snai1 MO3
Synonyms:
mRNA Target: snai1

Morpholino Type: uncategorized morpholino
Sequence:
5' AATGACCGGGGCATGTTGCTGAGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GGCTCAGCAACATGCCGCGGTCATT 3' |||||||||||||||| |||||||| 3' CCGAGTCGTTGTACGGGGCCAGTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold2511:571856..571880 25/25 unknown
tropicalis 7.1 scaffold_10:12980322..12980346 24/25 Antisense target snai1
Publications
First: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation., J Cell Biol 2015                      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556