Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306476

Morpholino Name: snai1 MO3
Synonyms:
Target mRNA: snai1

Morpholino Type: uncategorized morpholino
Sequence: 5' AATGACCGGGGCATGTTGCTGAGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GGCTCAGCAACATGCCGCGGTCATT 3' |||||||||||||||| |||||||| 3' CCGAGTCGTTGTACGGGGCCAGTAA 5' 5' GGCTCAGCAACATGCCCCGGTCATT 3' ||||||||||||||||||||||||| 3' CCGAGTCGTTGTACGGGGCCAGTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:10476516..10476540 25/25 Antisense target snai1.L
tropicalis 10.0 Chr10:36199227..36199251 24/25 Antisense target snai1
Publications
First: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation., J Cell Biol 2015                      
Most recent:
View All Papers