Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306480

Morpholino Name: sox2 MO5
Synonyms:
mRNA Target: sox2

Morpholino Type: uncategorized morpholino
Sequence:
5' CCATCATGCTGTACATCGAGGCGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCCGCCTCGATGTACAGCATGATGG 3' ||||||||||||||||||||||||| 3' CGGCGGAGCTACATGTCGTACTACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:104269267..104269291 25/25 Antisense target sox2.L
chr5L:104269267..104269291 25/25 Antisense off-target LOC108716997
chr5S:88904498..88904522 23/25 Antisense off-target LOC108718087
chr3S:104112652..104112676 21/25 unknown
Publications
First: Regeneration of Xenopus laevis spinal cord requires Sox2/3 expressing cells., Dev Biol 2015                                
Most recent: Spinal cord regeneration in Xenopus laevis., Nat Protoc 2017        
View All Papers