Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306481

Morpholino Name: sox3 MO4
Synonyms:
mRNA Target: sox3

Morpholino Type: uncategorized morpholino
Sequence:
5' GTCCAACATGCTATACATTTGGAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GCTCCAGATGTATAGCATGTTGGAC 3' |||||| |||||||||||||||||| 3' CGAGGTTTACATATCGTACAACCTG 5' 5' GCTCCAAATGTATAGCATGTTGGAC 3' ||||||||||||||||||||||||| 3' CGAGGTTTACATATCGTACAACCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15436:487977..488001 25/25 Antisense target sox3.S
Scaffold151989:147377..147401 24/25 Antisense off-target Xelaev16015158m
Scaffold137317:662783..662807 21/25 unknown
Scaffold13787:4748408..4748432 21/25 unknown
Scaffold30080:720907..720931 21/25 unknown
Scaffold45741:167003..167027 21/25 unknown
Scaffold5732:11189642..11189666 21/25 unknown
tropicalis 7.1 scaffold_8:35310185..35310209 24/25 Antisense target sox3
scaffold_5:22681651..22681675 21/25 unknown
Publications
First: Regeneration of Xenopus laevis spinal cord requires Sox2/3 expressing cells., Dev Biol 2015                                
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556