Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306481

Morpholino Name: sox3 MO4
Synonyms:
Target mRNA: sox3

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCCAACATGCTATACATTTGGAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' GCTCCAGATGTATAGCATGTTGGAC 3' |||||| |||||||||||||||||| 3' CGAGGTTTACATATCGTACAACCTG 5' 5' GCTCCAGATGTATAGCATGTTGGAC 3' |||||| |||||||||||||||||| 3' CGAGGTTTACATATCGTACAACCTG 5' 5' GCTCCAAATGTATAGCATGTTGGAC 3' ||||||||||||||||||||||||| 3' CGAGGTTTACATATCGTACAACCTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:61007080..61007104 25/25 Antisense target sox3.S
chr8L:33820535..33820559 24/25 Antisense target sox3.L
chr2S:133055793..133055817 21/25 unknown
chr3S:23329146..23329170 21/25 unknown
chr6S:4483912..4483936 21/25 unknown
chr9_10L:72420851..72420875 21/25 unknown
chr2L:90318363..90318387 21/25 unknown
tropicalis 10.0 Chr8:55347983..55348007 24/25 Antisense target sox3
Chr5:118541947..118541971 21/25 unknown
Publications
First: Regeneration of Xenopus laevis spinal cord requires Sox2/3 expressing cells., Dev Biol 2015                                
Most recent:
View All Papers