Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306899

Morpholino Name: rab4b MO1
Synonyms: rab4
mRNA Target: rab4b

Morpholino Type:
Sequence:
5' GGAAGTCGTATGTCTCAGACATGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' AACATGTCTGAGACATACGACTTCT 3' | |||||||||||||||||||||| 3' TAGTACAGACTCTGTATGCTGAAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5925:783245-783269 21/25 Antisense off-target Xelaev16064631m
Scaffold85591:1638762-1638786 21/25 unknown
tropicalis 7.1 scaffold_8:64353106-64353124 23/25 Antisense target rab4b
Publications
First: Rab5 and Rab4 regulate axon elongation in the Xenopus visual system. [J Neurosci 2014]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556