Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17306974

Morpholino Name: hes4 MO5
Synonyms:
mRNA Target: hes4

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTTCTCCATACTATCTGCAGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCCTGCAGATAGTATGGAGAAGC 3' ||||||||||||||||||||||||| 3' TACGGACGTCTATCATACCTCTTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold66475:1368097..1368121 25/25 Antisense target hes4.L
Scaffold169907:2581693..2581717 24/25 unknown
Scaffold175133:838589..838613 24/25 Sense off-target gipc1.L
Scaffold227074:55..79 24/25 unknown
Scaffold15436:7532099..7532123 21/25 unknown
Scaffold43061:1097445..1097469 21/25 unknown
Scaffold4321:13665211..13665235 21/25 Antisense off-target Xelaev16053204m
Publications
First: Functional analysis of Hairy genes in Xenopus neural crest initial specification and cell migration., Dev Dyn 2015                              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556