Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17307016

Morpholino Name: kdm2a MO1
Synonyms: Kdm2aMO
mRNA Target: kdm2a

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' TGTATCGCAGTTGCTCCTCTTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' ATGGAAGAGGAGCAACTCCGATACA 3' ||||||||||||||||| ||||||| 3' TACCTTCTCCTCGTTGACGCTATGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold11978:985872..985896 25/25 Antisense off-target Xelaev16005141m
Scaffold39604:418469..418493 25/25 Antisense off-target Xelaev16050327m
Scaffold1187:251504..251528 21/25 unknown
Scaffold50094:689717..689741 21/25 Antisense off-target Xelaev16058340m
tropicalis 7.1 scaffold_67:101941..101965 24/25 Antisense target kdm2a
scaffold_8:1659425..1659449 21/25 Sense off-target snapc4
Publications
First: Kdm2a/b Lysine Demethylases Regulate Canonical Wnt Signaling by Modulating the Stability of Nuclear β-Catenin., Dev Cell 2015                                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556